RT-PCR (5’catagacggcacttgtcgag 3′) and R (5′ cctgttggcagcctttagac 3′) CHH-1:

RT-PCR
screening of collected shrimp samples

Total
RNAs were extracted from shrimp pleopods using TriReagent (Qiagen), following
the manufacturer’s instructions.  Purity
of extracts was evaluated by the ratio between the readings at A260/280 nm.
The extract was then stored at -80°C. A quantity of 100 ng of the total RNAs
were processed for RT-PCR.  The
extracted RNA was determined for the presence of LSNV by using SuperScriptÔIII
One-StepRT-PCR system with Platinum® Taq DNA polymerase Kit (Invitrogen,
Carlsbad, CA). The RT-PCR reagent contained 2x Reaction Mix, template RNA,
sense primer (10µM), anti-sense primer (10µM) and SuperScriptÔIII
RT/Platinum® Taq Mix. The RT-PCR reagent, 11.5?µl, was pipetted into
each 0.5 ml reaction tube with proper label. 1 µl of the extracted RNA sample,
DEPC-water (for negative control) and positive control was added into each
reaction mixture and amplification process was carried out as follow: 50 °C, 30
min for cDNA synthesis; 94 °C, 2 min for denaturation followed by PCR
amplification, which starts at the same temperature for 15 sec for
denaturation; 55 °C, 30 sec for annealing; and 68 °C, 1 min for extension. The
amplification was carried out for 35 cycles, and ended by the last 68°C, 5 min
for final extension.

We Will Write a Custom Essay Specifically
For You For Only $13.90/page!


order now

Quantification
of MIH-1 and CHH-1 transcripts levels

Specific primer for MIH-1
and EF-1? were designed based on complete sequence of MIH-1
(GenBank acc. no. AY496454), and a partial sequence of the control gene, the
elongation favtor (EF-1?) (GenBank acc. no. DQ021452); the expected
amplicon sizes were 172 and 140 bp, respectively (Namwong, 2009). Specific
primer for P. monodon CHH gene were designed based on a complete
sequence of CHH-1 (GenBank acc. no. AY346378,
nt 183-391) by using Primer 3 software; and
the expected amplicon sizes was 199 bp. The specific primers were as
follow:

      MIH-1: F
(5’catagacggcacttgtcgag 3′) and R (5′ cctgttggcagcctttagac 3′)

      CHH-1: F (5′
ccagaagcctctcctgtgac 3′) and R (5′ acaactgggtgggttactgc 3′)

     
EF-1?: F (5’gaactgctgaccaagatcgacagg 3′) and
R (5´gagcatactgttggaaggtctcca 3´)

The screening test of MIH-1,
CHH-1 and EF-1? mRNA expression from total RNA was conducted by
RT-PCR. Shrimp eyestalk was isolated as described in 2.1.1, whereas RT-PCR was
done as described in 4.2.1.2 by using the above primer. The PCR product was
then analyzed by 1.2% ethidium bromide agarose gel electrophoresis. To check
the sequence of CHH-1 after amplification, the PCR product was purified by
QIAquick PCR purification kit (QIAGEN, Hilden, Germany) and the DNA
concentration determined by spectrophotometry with the absorption at OD260. The
purified PCR product was then ligated to pGEM®-T easy vector system (Promega, Madison, WI) (Fig. 4.2). The mixture,
10 ?L of total volume (1 ?L of 200 ng DNA fragment, 3 ?L of 50 ng pGEM®-T easy
vector, 5 ?L of 2x ligation buffer, and 1 ?L of T4 DNA ligase) was incubated at
4 °C overnight. The content was then transformed into the competent cells, E.
coli XL1 blue. Briefly, 50 ?L of prepared competent cells (stored at -80
°C) was added with the ligation mixture, incubated on ice, 30 min in the
microcentrifuge tube. The reaction tube was heated in the water bath at 42 °C
for 2 min and placed on ice for 2 min. The LB medium (10 g Bacto-Tryptone,
(Difco 0123-01-1), 5 g Bacto-yeast extract (Difco 0127-05-3), 10 g NaCl, ddH2O
to 1 L), 500 ?L was added to the ligation tube, and mixed before incubated on
the shaker at 37 °C for 1 h. The transformed reaction of 200 ?L was plated on
the LB/amplicilin/X-gal plate (10 g Bacto-Tryptone (Difco 0123-01-1), 5 g
Bacto-yeast extract (Difco 0127-05-3), 10 g NaCl, 15 g Bacto-agar (Difco
0140-01), ddH2O to 1 L) containing 100 ?g/ml ampicilin, and 80 ?g/ml X-gal. The
plate was incubated overnight, at 37 °C, for 16 h. PCR on colonies of bacteria,
E. coli was conducted to analyze the transformants. PCR reaction 25 ?L
total volume consisting of 18 ?L ddH2O, 2.5 ?L 10x buffer, 0.75 ?L MgCl2, 0. 5
?L dNTP, 1 ?L sense primer, 1 ?L antisense primer, 0.25 ?L Taq DNA
polymerase (Invitrogen), and E. coli cells was done for 25 cycles
(denaturation at 94 °C for 5 min 30 sec, annealing at 55 °C for 30 sec,
extension at 72 °C for 30 sec, and terminating with final extension at 72 °C
for 5 min) using primers, SP6 and T7 promoter. The products were separated on
1.2% agarose gel, and visualized with an ethidium bromide. Single colony was
subcloned in LB medium containing ampicilin overnight at 37 °C on shaker. Cells
containing inserted plasmid DNA were then extracted using QIAGEN Plasmid Mini
Kit (QIAGEN, Hilden, Germany). PCR was done to confirm the insertion using gene
specific primers before DNA sequencing. The sequences of a single colony were
then compared with the CHH-1 sequences using ClustalW (http://www.ebi.ac.uk/Tools/
clustalw2/index.html).